Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_539C4-5S
Clone ID CMHD-GT_539C4-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_539C4-5S
Sequence
AATTCAGTTGCTTCCTAAGAAATAGCTGTCATTGTATCAAAGTGACAGAGCAGGAGTGATGCTTCTCTGCAAATAGTCTT
CATGGTCTTCTCCCAGAGCCCCCTCTGGATCCTGGCAGTGGGCTCCCAGTCCAGTGGCCTCAGGGACTTTGCAGACGCCG
CCCCCACCCCGCGCGCCCCCCACGTGGCCTCAGTCCCTTCCTCTCTCCCGACTTTCCAGGTGAACCACCAAAATCCGGAG
AACGAAGCGGCTACAGCAGCCCCGGCTCTCCCGGAACGCCTGGCAGTCGCTCGCGCACCCCATCCCTACCAACACCGCCC
ACCCGGGAGCCCAAGAAGGTGGCAGTGGTCCGCACTCCCCCTAAGTCACCATCAGCTAGTAAGAGCCGCCTGCAGACTGC
CCCTGTGCCCATGCCAGACCTAAAGAATGTCAGGTCGAAGATTGGCTCTACTGAGAACCTGAAGCACCAGCCAGGAGGTG
GCAAGGTAAGGGTGT
Sequence Type genomic DNA
Unitrap ID UNI30920

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104171364..104171858 493
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es