Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_537D8-3
Clone ID CMHD-GT_537D8-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_537D8-3
Sequence
GTGTATCACCCAGGACTACATCTGGCACAAGGGGATGCGCTGTGAGTCCATCATCACGGACTTCCAGGTGATGTGCGTGG
CCGTTGGCTCGGCTGCTCTCGTGCTTCTCCTCCTGTTCATGATGACTGTGTTCTTTGCCAAGAAGCTCTATCTGCTCAAG
ACTGAGAATACCAAGCTGCGGAGGACCAATAAATTCCGGACCCCATCTGAGCTCCACAACGACAACTTCTCCCTCTCCAC
CATTGCCGAGGGCTCTCATCCAAATGACGACCCCAGCGCTCCCCACAAAATCCAGGACCCTCTCAAGTCCCGCCTGAAGG
AGGAAGAGTCCTTTAACATCCAGAACTCCATGTCACCCAAACTTGAGGGTGGCAAAGGTGACCAGGATGACTTGGGGGTG
AACTGTCTGCAGAATAACCTAACCTGAGACTGAGGAAGAAGAGAGGAAAGGGGGGTGGGGGAGGGAAGGACTGTTGTCTC
CTCTCGGGCAGAGTCGGCTTCTTGTAACCATTTGTTAAGCTTTTCTTTTTCTGATCTCATGGCATGCTCTGATGTGTTTT
GTANGAGGGGAAACACTTAAAATAAGCAAAGAAACCGAGCAGGATTGCATATATCGGATGGTTCTTGTCTGTGCTCTCTG
TACGTTGCTTCTG
Sequence Type mRNA
Unitrap ID UNI33281

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110153463..110164951 386
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032482 (Cspg5) chondroitin sulfate proteoglycan 5 Gene [Source:MGI Symbol;Acc:MGI:1352747]

 
Come back to gene ENSMUSG00000032482


For any suggestions or comments, please send an email to unitrap@crg.es