Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_539A6-5S
Clone ID CMHD-GT_539A6-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_539A6-5S
Sequence
AATTTATTATGTATGACATACTGACCTCAGATTTGTTGGGTATCCCAGGCTGGCCTTGAACTAGATGTTGCTGAGTGCTG
GAATTACAGAAATGTAC
Sequence Type genomic DNA
Unitrap ID UNI2993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79240595..79240691 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020716 (Nf1) NM_010897 neurofibromatosis 1 Gene [Source:MGI (curated);Acc:Nf1-003]

 
Come back to gene ENSMUSG00000020716


For any suggestions or comments, please send an email to unitrap@crg.es