Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_545G11-3
Clone ID CMHD-GT_545G11-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_545G11-3
Sequence
CCCCCCCCTTTTTCCAAAACCCTCGAACAAAATGAAGACAAAAGAGATATAGAATTTTACTGCTGGCAGCATGTATATCT
TTCGTTTTGGCTTGGTTCGAGGAAGGGGAAGAAACGATTACAGCCTTTGTAGAGCCGTTTGTAATTCTGCTTATCTTGGT
AGCCAATGCAATCGTGGGTGTGTGGCAGGAAAGAAATGCTGAAAATGCAATAGAAGCTCTTAAGGAATATGAGCCTGAAA
TGGGCAAAGTGTATCGACAGGACAGAAAGAGTGTGCAACAAATAAAAAAAAAAAAAATAAATCCTGGTGATATAGTGGAA
ATTGCAGTTGGTGACAAAGTTCCTGCTGATATTAGATTGACATCCATCAAGTCTACAACTCTAAGAGTCGACCAGTCAAT
TCTTACAGGTGAATCTGTCTCCGTCATCAAGCATACTGACCCTGTCCCTGACCCCCGAGCTGTTAATCAAGAC
Sequence Type mRNA
Unitrap ID UNI23606

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122921198..122950788 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029467 (Atp2a2) NP_001103610 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 Gene [Source:MGI Symbol;Acc:MGI:88110]

 
Come back to gene ENSMUSG00000029467


For any suggestions or comments, please send an email to unitrap@crg.es