Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_545H2-3
Clone ID CMHD-GT_545H2-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_545H2-3
Sequence
TACAGATTATGGCTACTTCCTGGCCAATGAAGCGTCACCTCTGACGGTGTCAGTCATCGATGACAAGCTCAAGGAGAAGA
TGGTAGTAGAGTTCCGCCACATGAGAAACCATGCTTATGAGCCGCTCGCCAGCTTCCTGGACTTCATAACTTATAGCTAC
ATGATTGACAACGTGATCCTGCTAATCACAGGCACACTGCACCAGCGTTCAATAGCTGAACTTGTGCCCAAGTGCCATCC
GCTAGGCAGCTTTGAGCAGATGGAGGCTGTGAACATCGCACAGACACCTGCAGAGCTCTACAATGCCATTCTGGTGGACA
CACCCCTGGCGGCTTTTTTCCAGGACTGCATCTCAGAGCAGGACCTTGATGAGATGAACATCGAGATAATCCGAAATACG
CTTTACAAGGCCTACTTGGAGTCCTTCTACAAGTTCTGTACTCTGTTGGGTGGGACCACAGCTGATGCCATGTGTCCTAT
CCTAGAGTTTGAAGCAGACCGCCGCGCTTTCATCATCACCATCAACTCTTTCGGCACAGAGCTGTCCAAGGAGGACCGTG
CCAAGCTCTTCCCGCACTGTGGCCGGCTCTACCCTGAGGGCTTGGCTCAGCTGGCGCGGGCTGATGACTATGAACAGGTC
AAGAATGTAGCTGATTACTACCCGGAATACAAACTGCTTTTTGAGGGTGCAGGTAGCAATCCTGGAGACAAGACCCTGGA
GGACCGGTTTTTTGAACATGAGGTGAAGCTAAACAAGCTGGCCTTCCTGAACCAGTTCCATTTTGGTGTCTTTTATGCCT
TTGTGAAGCTTAAGGAACAGGAATGTCGNCACATCGTATGGATTGCTGAGTGCATTGCCCAGCGCCATCGCGCCAAGATC
GACAACTACATCCCCATCTTTTAGCATTCT
Sequence Type mRNA
Unitrap ID UNI22766

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108048797..108063370 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013160 (Atp6v0d1) NM_013477 ATPase, H+ transporting, lysosomal V0 subunit D1 Gene [Source:MGI (curated);Acc:Atp6v0d1-001]

 
Come back to gene ENSMUSG00000013160


For any suggestions or comments, please send an email to unitrap@crg.es