Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_535F7-3
Clone ID CMHD-GT_535F7-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_535F7-3
Sequence
GTTTCCTGCTGAACCCCAAATTCCCTGAGAAGGTGGACGGACGCTTTTCTGCAGCCCCCTTGGTGGACCTCAGCTTGTCA
CCACCCTCTGGACTGGACTCTCCCAATGGCAGCAGCTCCCTGTCTCCTGAGTGCCAGGGCAATGGGGACTTGCCTCCACT
GCCTACTGCTGTGGATTTCCAGCCACTTCGCTATTTGGATGGTGTCCCCAGTTCCTTCCAGTTCTTCTTGCCCCTGGGTT
CTGGTGGGGCTCTGCACCTACCTGCTTCCTCCTTCCTTCCCCCCCCCAAGGACAAGTGCCTCTCACCAGAGCTGCCCCTG
GCCAAGCAGCTGGTGTGTCGATGGGCCAAGTGTAACCAGCTCTTTGAGCTCCTCCAAGACCTGGTTGACCATGTCAACGA
CCATCATGTCAAGCCTGAACAGGATGCTCGATACTGCTGTCATTGGGAGGGCTGCGCCCGCCATGGCCGTGGCTTCAATG
CCAGGTACAAGATGCTCATTCACATCCGGACACACACCAACAAGAAGCCGCCCCGATGCCCCACCTGTAACAAGAGCTTC
TCCCCCCTGGAGAACCTGAAGATCCACAACCGCTCCCACACAGGCATTGATGACCATGGACTGACAATATTCCTGCCTTC
GTCTCCAAGTGTTGGGATTACAGGCATGGCTTTCACCTCACCTTGATGTCACTTGCTGGGGTCCACACCTTACAAGGACA
TGCTCATCTGACACCACCTTAGGGTAGACAAACTGGGCCTGCTCCTCCTCACTGTTCCCTGAGCCCTGCAGAA
Sequence Type mRNA
Unitrap ID UNI5102

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4610258..4612191 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014303 (Glis2) NM_031184 GLIS family zinc finger 2 Gene [Source:MGI (curated);Acc:Glis2-001]

 
Come back to gene ENSMUSG00000014303


For any suggestions or comments, please send an email to unitrap@crg.es