Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_535D12-3
Clone ID CMHD-GT_535D12-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_535D12-3
Sequence
GCAAGTTGATGTAGAAATTGCCAAACAATCATGTGACTATCAAGACCATGCTCGGAAGATTTGGGAATGGATGATGAAGG
AGATGATGATCCTGTTCCTTTACCAAATGTTAATGCAGCAATTCTAAAGAAGGTCATTCAGTGGTGCACCCACCACAAAG
ATGACCCTCCTCCTCCTGAGGATGATGAAAAAAAAAAAAAAAAAAAAAAAGATATTCCTGTTTGGGACCAACAATTCATG
AAAGTTGACCAAGGAACACTTTTTGAACTTATTCTGGCTGCAAACTACTTAGACATCAAAGGTTTGCTTGATGTCACATG
CAAGACTGTGGCCAATATGATTAAGGGGAAAACTCCTGAGGAGATTCGTAAAACCTTCAATATCAAAAATGACTTTACTG
AAGAGGAAGAGGCCCAGGTACGCAAAGAGAACCAATGGTGTGAAGAGAAGTGAACTGCTGTGCCTGTCACTGTAACACTA
GAAGGGTTGTTCCAAATGCTAGTTGCACTGCTCTGTTTATAATTGTTAATATTAGAGATCAGTAGACAAACATCGCCTTG
TCTTCACTGCATGTGTAGTTCCAGTCCAGATCAGACCTGTGGCTGAGTTTCTTCTGTGAGCAGAAGTTTCCTTTTCCCCC
CATTACTCTGAATAAAACCGAACTATGGGTTCTCTGCGG
Sequence Type mRNA
Unitrap ID UNI10878

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52050382..52059748 264
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036309 (Skp1a) NM_011543 S-phase kinase-associated protein 1A Gene [Source:MGI (curated);Acc:Skp1a-002]

 
Come back to gene ENSMUSG00000036309


For any suggestions or comments, please send an email to unitrap@crg.es