Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_535E2-3
Clone ID CMHD-GT_535E2-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_535E2-3
Sequence
GAATGAATTGCTAGCATTGGACTGACATCAAGCCTGTGAAACCCATCAAAGCCAAGACCCCAGTACAAGCCCCCAGATGA
CAAGATGGTTCATGAGACCAGCTACAGCGCCCAGTTCAAAGGGGAGGCCAATAAGCCCAGTGCAGCGGACAACAAGGCCA
TGGATCGCAGAAGAATACGGAGCCTCTACAGTGAGCCTTTCAAGGAATGCCCGAAGGTAGAGAAACCTAGTGTTCAGAGT
TCCAAACCAAAAAAGACCTCAACGAGCCATAAACCCCCAAGGAAGGCCAAAGACAAGCAGGTGGTGTCGGGCCAGGCTGC
CAAGAAAAAGACCACAGAGGGCCCCAGTGCTACCAAACCCGACGACAAGGAGCAAAGCAAAGAGATGAACAATAAACTGG
CTGAGGCGAAAGAGTAAATGTAACAAAACTTCCATTCTCTCCCCTCCCCCACCCCCTATATTTAAACCAACCAACC
Sequence Type mRNA
Unitrap ID UNI24038

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 106464199..106466240 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055407 (Mtap6) NM_001043355 microtubule-associated protein 6 Gene [Source:MGI (curated);Acc:Mtap6-003]

 
Come back to gene ENSMUSG00000055407


For any suggestions or comments, please send an email to unitrap@crg.es