Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_510H12-3
Clone ID CMHD-GT_510H12-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_510H12-3
Sequence
GGTTTTGGGACATGCTAGACAGTTGTCCATAGAGAATATTATTATGAAATTTGATGAACTTCATCAGCTAAAGGCCAATA
ATTGGAAACAGATGGATCCTCTTGACAAGAAGGTAGAACAATGTAGATTTTGTATGGTCCATTTAAAACCCTGCACAAAC
GCTGGACAGTCTAAATAGGCTGCTGCATTCAGTCCTGCTGTTCACAATGTGAAATGGAGCCGGTACTGTGTCATCTCATT
GTAATGACAATGTTTACATACTAATCACTCGGGATAGTATCTGTAATGTGTCTCAGGCATATTTTTGAAGAAAAACCTGT
CTTTGTGAATTGGGAAACGGGAATGTGGCTTTTCTTTACCTTTTTCTTTCTCTTTCTTTCTTCCTTTACTTTTCTTTCAT
TTCTTTCTTTCTCTCTCTCTCTCTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTTTTTCCTT
TTCCAGTTAAATTAAACTTTAAGCTAAACCAGTTAGACACTGGGAGGGACTGCCTCCAGTTATGCTTTCTAAACTAAAAT
AAATGATTTCTTCAGTGC
Sequence Type mRNA
Unitrap ID UNI21962

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71164577..71165038 450
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003279 (Dlgap1) NM_177639 discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]

 
Come back to gene ENSMUSG00000003279


For any suggestions or comments, please send an email to unitrap@crg.es