Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_535C3-3
Clone ID CMHD-GT_535C3-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_535C3-3
Sequence
CCCTAACCCCTCTCCAACTCCACCAAGAGGAGACCTCCAGCAGATAATTGTCAGTTTGACAGAATCCTGTCGAAGCTGTA
GCCATGCCCTTGCTGCTCACGTTTCTCACTTGGAGAATGTGTCAGAGGAAGAGATGGACAGACTCCTGGGAATTGTGTTG
GATGTGGAGTACCTCTTCACCTGCGTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAATGTTGTGTCTGTTTTTTTCTCCAA
TAAAAAAGAGAAAGTCAATTTTACGAAGAGGAAAACCTGTGGTTGAAGGCTCCTTGGAGAAGAAGCCGCCATTTGAGAAG
CCCAGTATTGAACAGGGTGTGAACAACTTCGTGCAGTACAAGTTTAGTCACTTGCCATCGAAAGAGAGGCAGACAACGAT
CGAGCTGGCCAAGATGTTTCTGAACCGCATCAACTACTGGCATCTGGAGGCTCCATCTCAGCGGAGACTACGGTCTCCCA
ATGATGACATCTCTGGATACAAGGAAAACTACACAAGAAAAAAAGGGACAAAAGAGGAAGAGAGAAAGAAAGAAAGAAAG
GAAGGAAGGAAGGAAGGAAGGAAGGAAGAAAGAAGGAAAGAAGGAAAGAAGGAAAGAAGGAAAGAAGGAAAGAAGGAAAG
AAGGAAAG
Sequence Type mRNA
Unitrap ID UNI2494

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53750224..53773093 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000708 (Kat2b) NM_020005 K(lysine) acetyltransferase 2B Gene [Source:MGI Symbol;Acc:MGI:1343094]

 
Come back to gene ENSMUSG00000000708


For any suggestions or comments, please send an email to unitrap@crg.es