Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_510F5-3
Clone ID CMHD-GT_510F5-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_510F5-3
Sequence
CAGCGAGGACCATTCACCCAAGCATGGCTCACAGAGGCTATTCACGCTACCTATGTTTCGCAAAATGAAGCCTCCTGACC
TGTGTCAGGATAATATGGGCTTGCTGCAGTCCCAGACCATGGACCTGGACAGGACTACCCTCAATCAAGTGAGCGGCAGA
TCCTTTCACTGACCGAAGCCTATGCTAGCACTTCTGAAGGCCCAGAACAGACTCCTGTTTCCGCCCGTACTCGGAACACC
CTTCTAAGACTCCCAATGATTGAGAAGCGTTTGCGAGAATCAGAGTTTAGCCGTTATCTCGGCGAAGATGACAACGTTGC
CAAGACTTCACCTACGGCTTCAGTAAACAAAATAGAATATGCTGCACGAACATCAGAGAGCTCAGAAGAATTCCTTGAAG
AAGAGCCTGAGCAGGGAGTGATTGACTTTGAGGATGAAAGCGGTGATAAAGATGCACAGCCTGCTCTGGAAACTCAGCCA
CGCCTGCAGAAA
Sequence Type mRNA
Unitrap ID UNI16014

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 96949195..97888471 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es