Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_112E8-3
Clone ID CMHD-GT_112E8-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_112E8-3
Sequence
GCACCAGGCACTCTGGGACCGCTACATGGGCACCCTCCGTGGCTGCCTTCTGCGCCTCTATCATGATTAAAGCCCTTTTC
CTTCCTCCCTCCGACATACCCTGAGAATAAAGTTGCCATAAGTTTG
Sequence Type mRNA
Unitrap ID UNI14006

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5464925..5465050 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024911 (Fibp) NP_067413 fibroblast growth factor (acidic) intracellular binding protein Gene [Source:MGI Symbol;Acc:MGI:1926233]

 
Come back to gene ENSMUSG00000024911


For any suggestions or comments, please send an email to unitrap@crg.es