Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_112H6-3
Clone ID CMHD-GT_112H6-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_112H6-3
Sequence
GTGTTCCTATATTTCTCCAAAGACCAAGGGGAAGAGGAAGAGAGCAGTCGGCAGGAGGCTGAAGAAGAGGAGGTTTCCAA
ACCTGGCCGGCAGCATCCCAAACGTGTCAGCCGATTCCTGGAAGACCCCAGCTCTGTGGAGACCATGATCTGAGCATGCC
TGCCTTGGGACTGAGTGGCAAAGCTCAGACAGAGGATCTCTGTACCATACGCTGGCTCCCAGAAAGCCTTGGGCTCTGGG
GGAAATAAAAAGAAACTAGAATG
Sequence Type mRNA
Unitrap ID UNI37140

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79478051..79478313 263
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035722 (Abca7) NM_013850 ATP-binding cassette, sub-family A (ABC1), member 7 Gene [Source:MGI Symbol;Acc:MGI:1351646]

 
Come back to gene ENSMUSG00000035722


For any suggestions or comments, please send an email to unitrap@crg.es