Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_364H12-3
Clone ID CMHD-GT_364H12-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_364H12-3
Sequence
AGCTCTGAACATGTCCGAGTTTGTCTGTGACCGGTCAGCAAGGCCTTATGTTTATGACCTAATTGCTGTGTCCAATCACT
ATGGAGCCATGGGGGTTGGTCACTGTAAGTATTGGCATCTGCTTCCTTCTGAGACACTGCATATGCGAAGAACAGACTGA
ACGGGAAATGGTATTACTTTGATGATAGCAGTGTGTCCCTGGCCTCTGAGGACCAGATAGTGACGAAAGCCGCCTACGTG
TTGTTCTATCAGCGTCGGGATGACGAATGCTCCAGCACATCTTCGCTCGGCAGTTTCCCCGGTTCTGATGGAGGGGTGAA
GCTGAGCAGCTCACACCAGGGCATGGGGGATGAGGAGGCTTACAACATGGACACCAACTGATGTGGCCTCTGTGACCCTG
CCACCCTCCCAACACCAGCATCCTCCCCCAGGAGAATATCTGTGGCACTCTTGAAGACTGCTCATATCAATCTCAAACCA
GATGAGGACATTACCTCCTTTTATGAGAAGAGGAAGGAAAGAGAAACCCTGCTTTCTGAGAAGGGCTCTATGTTAAGAGG
CTGGATTATTTTTTCTTTTAAACGGGTGGTGAGAGAAAAACCTGTGGAGCTCAATTGTGGGCTGGGGTTTGGTGCACAGT
GGCATGTGTCTCATGGATTCCAAAGAGTGGAGAGGAAGACCCTGCAATGAGCATGGTGCAGCCATGAAGACCCACCTGC
Sequence Type mRNA
Unitrap ID UNI30436

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108290608..108294506 498
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032612 (Usp4) NM_011678 ubiquitin specific peptidase 4 (proto-oncogene) Gene [Source:MGI Symbol;Acc:MGI:98905]

 
Come back to gene ENSMUSG00000032612


For any suggestions or comments, please send an email to unitrap@crg.es