Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_515B8-3
Clone ID CMHD-GT_515B8-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_515B8-3
Sequence
AGTGAAAGCAACTTCCTCCTTGTCTTGGATGCCAAGAGCTTCACAGAGCTGGGGCGAGCGGAAGTACCCGTGCAGATGCC
TTACGGGTTCCATGGCACCTTTGTGCCTATCTGACGGCAGAGGCTCAAGGAAGGCTAGGATCGGGCTTCGATGAGCACAC
TCTGAGGAAAAGAGAAAATGGTGGATCTCACTCAAAAGCTGTTGTAGTTTGGACCTGACCCTGACCCCTAAGGACTCATA
GAACCGACTCCCGTGGGCTCATCGACCCTGACCCCCAACGGGCTGATAGATCCTGACCACCACGGGATCATATTTAAATT
CTTGTTCCCAGCTTGTGGCACTAC
Sequence Type mRNA
Unitrap ID UNI37144

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 50341281..50341624 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032066 (Bcdo2) NM_133217 beta-carotene oxygenase 2 Gene [Source:MGI (curated);Acc:Bcdo2-001]

 
Come back to gene ENSMUSG00000032066


For any suggestions or comments, please send an email to unitrap@crg.es