Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_514G4-3
Clone ID CMHD-GT_514G4-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_514G4-3
Sequence
CCGATGCAGTGGTGCAGTACGATGTGGAGCTGATCGCTTTGATTCGAGCCAACTACTGGCAGAAGCTGCTAAAGAGCATT
TTGCCTCTGGTAGGCATCGCCATGGTGCCGGCGCTCCTGGGGCTGATCGGGTATCACCTGTACAGAAAGGCCAGCAGACC
CAAAGTCTCCAAAAAGAAGCTAAAAGAGGAGAAACGAAACAAGAGTAAGAAGAAATAAATAGTGGTTTTTAAC
Sequence Type mRNA
Unitrap ID UNI18273

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 98554801..98555033 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003355 (Fkbp11) NM_024169 FK506 binding protein 11 Gene [Source:MGI Symbol;Acc:MGI:1913370]

 
Come back to gene ENSMUSG00000003355


For any suggestions or comments, please send an email to unitrap@crg.es