Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_523F7-3
Clone ID CMHD-GT_523F7-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_523F7-3
Sequence
AAGGAAGATGAAGGCCCGTGCTCCGCCACCTCCTGGAAAGCCTGCTGCCCAGAATGTCCACAGCGAACAGAAACTGCCCC
ATGATGCCACCCTGGGATCCCAGCAAAGCCTGGTCTACATGAAGGAGGCACTGCAGAACAGCACCTTGGACATCACCGTG
GTTCTGCCCAGTGGACTGGAGAAGCAGAGTGTGGTTAGTGGGAGCCACGCAATGATGGACCTACTGGTTGAACTCTGCCT
TCAGAACCACCTGAATCCTTCTCACCACGTCCTAGAGATCTGGTCTTCTGAGACCCAACAGCCTTTGAGTTTTAAGCCAA
ATACGTTGATTGGGTCCTTGAATGTGCATACTGTACTTCTGAAAGAAAAAATCCCTGAAAAAAGAATTAAACCTGGCCTA
ACCAAGGGTCCTGAAAAATCTGTACGAATGGTAATGAACTACCTGAAAACGCAAAAGGGTGTCGTGCGGGTGAACCCTGA
AGTGCCACTACAGAATATTCTGCCAGTCATCTGTGCGAAGTGGGAAGTCAACCCAAAACACGTGATTCTGCTCAAAAACA
ATGTTGCCGGGGAAGAACTGGAACTGTCCAAGTCCCTGAATGAACTAAGGATCAAGGAACTGTATGCGTGGGACAACAAA
AAAAAAATGTTTAAAAAATCATCACTTGGCAATGATGAAACAGAAAAAGAAAAAAAAAAGTACTC
Sequence Type mRNA
Unitrap ID UNI15950

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 12269638..12286769 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020173 (Cobl) NM_172496 cordon-bleu Gene [Source:MGI (curated);Acc:Cobl-003]

 
Come back to gene ENSMUSG00000020173


For any suggestions or comments, please send an email to unitrap@crg.es