Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_514F11-3
Clone ID CMHD-GT_514F11-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_514F11-3
Sequence
TCCAGGTTCTGTGAATCATTGAACTGGAGGGAGGAAAGACAGGTCTACGGAGCTGCCCACAAGCTGTGTAGTGGACTCTG
GATGCGGCTAGCTGTGTCAGCACCATGCTGAGGTGGGCTTCTTGGTGCTGAAGCTGCCCGAGTCTCCTATCTAAGGGACC
CCAATAAAGTCATTGTTCCCCT
Sequence Type mRNA
Unitrap ID UNI21022

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 135390122..135390302 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008843 (Cldn13) NM_020504 claudin 13 Gene [Source:MGI (curated);Acc:Cldn13-001]

 
Come back to gene ENSMUSG00000008843


For any suggestions or comments, please send an email to unitrap@crg.es