Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_542B7-5S
Clone ID CMHD-GT_542B7-5S
Vector GepNMDi3
Project cmhd

SPLK-Sequence tag CMHD-GT_542B7-5S
Sequence
ATAGTAGATTGTTCTTAAATGATGATATAATTATTGTCAGAACTTTTATGTGAAGATCTGTTCAGTAGATTTATTTTCTG
TCTTAGAAGAGAAACAGAAGAGTGATGCTGAAGAAGATGGTGTTACTGGCAGTCAAGATGAGGAAGATAGCAAGCCTAAA
GCAGAGGTAAGGGAGGGATAATAAATACTTCAGGCAACAAAGCTGACAGCGTAAACAGTCCTGTGACACTTATATCTCCT
CACTGTCCCCTCAAAGGTATTTCTTGAATACCACTGCATTTTAAACTATTTTTGGTTTTTCAAGACAGGGCTTCTCTGTG
TAGCCCATCGTGGCCTGGAACTCAGAGGTCTGCATGCCTTTGCCTCCCAAACTTTTTGAGACAGGCTTTCATGTAGTCTA
CACTATCCTTTCATTCTGTGTAGTCAAGGGTAATATTTATTGATCCTGTAATCTTTCTGCCTCCATTCCTAGTATGTGCT
CATACAGGTATGTGCTCTACCCTATTTTATGTGGTGCTGTGGGTGCTCCCAAGAGCACCTGGATTCAATTCTCAGTACAC
ATATGATGGCCCACAGCTATCTGTAATTCCAATCCCTGGGGTTCTGATGCCCTCTTCTGGCTCTGAGCTCATCAGGCATG
CACAGGGTAGAGATACAGATCCAGGCAAATGCAAATTAAATAAAAGTAAAATCCTCCACCACAGTTTTTAAAAAGTTAAT
AGGTTTAGGGAAAGTACATGTTTTCTGAAAAGAAAGACTAAAATCGAATACCTATAATTCCAGTACCTTTCCACCAATTG
AATGACTTAGTTTAAAT
Sequence Type genomic DNA
Unitrap ID UNI37143

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50109909..50110725 817
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020368 (Canx) NM_007597 calnexin Gene [Source:MGI (curated);Acc:Canx-001]

 
Come back to gene ENSMUSG00000020368


For any suggestions or comments, please send an email to unitrap@crg.es