Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_477C7-3
Clone ID CMHD-GT_477C7-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_477C7-3
Sequence
GCAGCTGTGTTAATGGAGCAGGAACGGCAGCAGGAGATCGCCAAGATGGGCACTGCAGTCCCTCGGCCGCCTCAGGATAT
GGGGCAGCTGGGTGTCCGTACTCCTCTGGGGCCTCGCGTAGCTGCTCCAGTAGGCCCTGTGGTTCCCACGCCTACGGTTT
TGCCCATGGGGGCACCTGTTCCTCGCCCTCGGGGTCCCCCCCCACCCCCTGGAGATGAGAACAGAGAGATGGATGATCCT
TCTGTGGGCCCCAAGATCCCCCAGGCTTTGGAAAAGATTCTTCAGCTGAAGGAGAGCCGGCAGGAAGAGATGAACTCTCA
GCAGGAGGAGGAGGAAATGGAGACAGATACTCGCTCATCTCTGGGACAGTCAGCATCAGAGACTGAGGAGGACACGGTGT
CCATATCCAAAAAAAAAAAAAACCAAAAGCGTCGGAACCGAAAGAAGAAGAAAAAGCCAACAACGGGTGCGGGCAGCCTC
ATCAGAGAGCTCTGGGGACCGAGAGAAGGACTCCGGTCGGTCCCGCGGCTCGGACCCCCCTGCTGCTGACGTGGAGATTG
AGTATGTGACCGAGGAGCCTGAGATCTACGAGCCCAATTTCATCTTCTTCAAGAGGATTTTTGAGGCTTTCAAGCTAACT
GATGATGT
Sequence Type mRNA
Unitrap ID UNI37150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5286935..5291422 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024853 (Sf3b2) NM_030109 splicing factor 3b, subunit 2 Gene [Source:MGI Symbol;Acc:MGI:2441856]

 
Come back to gene ENSMUSG00000024853


For any suggestions or comments, please send an email to unitrap@crg.es