Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_488F9-3
Clone ID CMHD-GT_488F9-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_488F9-3
Sequence
ATGCAGCTGCCATCTTGCTGGATGAACAGAACAAGCGGCCCTGCAGGAAATTCCTGCTGACAGGCCAGTGCGACTTTGGC
TCCAACTGCAGGTTTTCCCACATGTCAGAACAAGATCTGCAGGAGCTGAGCGTCCAGGTGGAAGAGGAGAGGCGGGCCAG
AGAATGGCCACTGGAGACCGCCGAGCTTCCTGAGGGCCACCTGGAGGACTGGCTGGAGAAGAGAGCTAAGAGGCTAAGCT
CAGCCCCAAGTAGCAGGGCTGAACCCATCAGAACCACTGTCTTCCAGTATCCAGTGGGCTGGCCGCCAATGCAGGAGCTG
CCCCCCTCCCTGCGGGCACCCCCACCTGGAGGGTGGTCCGTACTGTCCAAAGTCCAGTGGGGCTGAGCTCTTCCTCACCT
CCCCCTGCCTGACTTCAACCTGTCTCATCAGTCACAGTAAAGACAATTGCCTAACCGAGGAAGCAGAGCTGCCTTCCCTC
CCTTCTCCCTGGGGCCTCTGAGCCTGGCCGCCCATCCACCCACCATCCCTCAGGGCGTTTCTCAAGAAGATGGGTGAGAA
ACATCCGAATGTTTATAAAAAAGTCTGTCCTTG
Sequence Type mRNA
Unitrap ID UNI14153

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4628588..4637671 340
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009076 (Zmat5) NM_026015 zinc finger, matrin type 5 Gene [Source:MGI (curated);Acc:Zmat5-001]

 
Come back to gene ENSMUSG00000009076


For any suggestions or comments, please send an email to unitrap@crg.es