Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_488H8-3
Clone ID CMHD-GT_488H8-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_488H8-3
Sequence
TCTTCATCTGAAGAGAGTTCTGCAGGAGGACTGGGGCGTCTTGACAGGTCTGGGTCTGGCCCCTGATGGCCAGTCTCTCA
TCTTGATGAAAGAGGATGTGGAATTACTAGAGATGAAGCCTGGGTCTATTCCATCTTCTATCTGCAAGAGGTATGGAGTA
CATTCTTCAATACTGTGCACCAGCAAGGAGTACGGCTTGTTCTACCTGCGGCAGGGGGACTCGGGATTACTTTCTATATT
GGAGCAAAAGGAGTCAGGGGAGTTTGAAGAGATCCTGGACTTCAATCTGAACTTAAATAATCCTAATGGGTCCCCATTAT
CAATCACTCAGGCCAAACCTGAGTCAAAATCATCCCTTTTGTGCGCCACCTCTGATGGGATGCTGTGGAACTTATCTGAA
TGTACCCCAGAGGGAGAATGGATCGTAGATAACATTTGGCAGAAAAAAGCAAAAAAAAAAAAAACTCAGACTCTGGGGAC
CGAGTTGTCCCCGCACTCAAATTTGGATTTCTCCATGGACTGCTGGATTGATCCCACACATTTAAAGGCACAGCAGTGTA
AAAAGATCCACTTGGGCTCTGTCACAGCCCTCCATGTGCTTCCGGGATTGCTGGTGACAGCTTCGAAGGACAGAGATGTT
AAGCTGTGGGAGAGACCCAGTATGCAGCTGCTGGGCTTGTTCCGATGTGAAGGGCCAGTGAGCTGTCTGGAACCTTGGAT
GGAGCCCAGCTCTCCCCTGCAGCTTGCTGTGGGAGACACACAAGGAAACTTGTATTTTCTATCTTGGGAATGAAGATGCA
GTACTCAGGACAAAGATGATGTCAACAGATGCTGCTAG
Sequence Type mRNA
Unitrap ID UNI37153

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 51443798..51446874 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006281 (Tep1) NM_009351 telomerase associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:109573]

 
Come back to gene ENSMUSG00000006281


For any suggestions or comments, please send an email to unitrap@crg.es