Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_490E3-3
Clone ID CMHD-GT_490E3-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_490E3-3
Sequence
GGTTTTACCCCCGTCGTGCATCCACACGAGTGCTTCTCTTGACATTTCTCGCAAATGGGAAAAAAAAAATAAAATTGTTT
ACCCACCTCAACTGCCTGGCGAACCTCGGAGACCAGCGGAAATTTACCATTGTCGGAGACAAATAAAATACAGCAAGGAC
AAGATGTGGTACCTGGCAAAGATGATACGAGGCATGTCCATTGATCAGGCTTTGGCGCAGCTGGAGTTCAATGATAAAAA
GGGGGCTCAAATCATTAAAGAGGTTCTCTTAGAAGCACAAGACATGGCAGTGAGAGACCATAATGTGGAATTCAGATCCA
ACTTACACATAGCTGAGTCTACCTCAGGCCGAGGCCAGTGCCTGAAGCGCATCCGTTACCATGGCCGAGGTCGCTTTGGC
ATTATGGAGAAGGTCTATTGCCACTATTTTGTAAAGCTGGTGGAAGGACCCCCTCCCCCACCCGAAGTACCCAAGACAGC
AGTTGACCACGCCAAGGACTATATTCAGCAGCTTCGCAGCCGGACCATCATCCATACTCTATGAGATCTGTGCAGGTCAT
CCTGGCTCCACGGTGTATATAGCTTATGTTTATTTTAAAAAGTAAAAACAAGTGATTTTT
Sequence Type mRNA
Unitrap ID UNI26960

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 57986535..57993067 291
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020514 (Mrpl22) NM_175001 mitochondrial ribosomal protein L22 Gene [Source:MGI (curated);Acc:Mrpl22-001]

 
Come back to gene ENSMUSG00000020514


For any suggestions or comments, please send an email to unitrap@crg.es