Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_487E1-3
Clone ID CMHD-GT_487E1-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_487E1-3
Sequence
GCACTTTGAGCCCTCTTCTCCTGTCTCACCTGCACAGGACACGAACAGGTGCAGCCTTGCCACCACCATGCCGGAAGTTG
AGAGGAAATCCAAGATCACTGCCTCCCGTAAACTCATGCTGAAGAGCCTGATGCTAGCCAAGGCCAAGGAGTGTTGGGAG
CAGGAACACGAGGAGCGAGAGGCTGAGAAGGTGCGTTACCTCTCGGAGCGCATCCCCACACTGCAGACCCGCGGTCTGTC
CCTCAGTGCCCTTCAGGACTTGTGCAGAGAGCTCCATGCCAAGGTGGAGGTGGTGGATGAGGAGCGCTATGATATTGAAG
CCAAATGCCTCCACAACACCAGAGAGATCAAGGACCTGAAGCTGAAGGTGCTGGACCTCCGTGGGAAGTTCAAGCGTCCT
CCCCTGCGCCGGGTCCGTGTCTCAACCGATGCCATGCTCCGAGCCCTACTGGGCTCTAAGCACAAGGTGTCCATGGATCT
GCGGGCCAACCTCAAGTCTGTGAAGAAAGAAGACACAGAAAAGGAGCGGCCAGTCGAGGTAGGAGACTGGAGGAAGAATG
TGGAGGCTATGTCTGGCATGGAAGGCCGCAAGAAGATGTTCGACGCTGCTAAGTCCCCGACCTCCCAGTAGAGGTT
Sequence Type mRNA
Unitrap ID UNI26714

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 137696550..137706314 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026418 (Tnni1) NP_001106173 troponin I, skeletal, slow 1 Gene [Source:MGI Symbol;Acc:MGI:105073]

 
Come back to gene ENSMUSG00000026418


For any suggestions or comments, please send an email to unitrap@crg.es