Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_487G10-3
Clone ID CMHD-GT_487G10-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_487G10-3
Sequence
GTGTCCAGTGATTTGAAGAATATTGACACAGAAGTTATTCCTAAAGCCAAGAGCCATGTGACTATCCGGCGGGCAGTTTT
AGAAAAAATTGGAAAAAAAAAAAAAAACAGACCCGCTCTGGTGGCGAATAAACCTCAGAACACCAAAGTACCAGCTCTGC
CCACCAAAGTGACAAATGTCAACAAGCAGCCGAAACCCACAGCCTCTGTGAAACCAGTGCAGATGGAGGCGCTAGCTCCC
AAGGATCGTCCTCCCGCCCCTGAGGATGTCTCCATGAAGGAAGAGAGCCTCTGCCAAGCTTTCTCTGATGCTCTGCTCTG
CAAGATCGAGGACATAGATAACGAGGACAGGGAGAACCCTCAGCTCTGCAGTGACTACGTGAAGGACATCTACCAGTACC
TCAGGCAGCTTGAGGTTTTACAGTCCATTAATCCACACTTCTTAGATGGAAGAGATATAAATGGACGTATGCGTGCCATC
CTGGTGGACTGGCTGGTCCAAGTCCATTCCAAGTTTCGGCTTCTGCAGGAAACTCTGTACATGTGCATTGCCATCATGGA
CCGGTTCCTGCAGGCTCAGCTGGTCTGCCGGAAGAAACTGCAGCTGGTCGGGATCACAGCTCTGCTCCTGGCTTCCAAAT
ATGAGGAGATGTTTTCTCCAAATATCGAAGACTTTGTTTATATCACAGATAATGCTTACACCAGTTCCCAAATCCGAGAA
ATGGAGACTCTGATTTTGAAAGAGTTGAAATTTGAGTTGGGCCGACCTTTGCCACTTCACTTCTTAAGGCGAGCCTCA
Sequence Type mRNA
Unitrap ID UNI23097

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70258474..70266936 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032218 (Ccnb2) NM_007630 cyclin B2 Gene [Source:MGI Symbol;Acc:MGI:88311]

 
Come back to gene ENSMUSG00000032218


For any suggestions or comments, please send an email to unitrap@crg.es