Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_487E9-3
Clone ID CMHD-GT_487E9-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_487E9-3
Sequence
TGTTTCCTCACGGCCTGCCTCCTCGGTACATGATGCAGGTGAAGACTTTTGGCGAAGCTTGTCTGATGGTCAGGAAGCCA
GCTCTCGAGCTTCTGGGCTACCTGAAAAATACCAATTTTGCTCATCCAGCTGTGCGATATCTTCTTTATGGGGAGAAGGG
GACAGGAAAGACCCTCAGTCTCTGCCATGCTGTTCATTTTTGTGCAAGACATGACTGGCTGATTCTGCATATCCCAGATG
CTCATCTTTGGGTAAAAAACTGCCGGGAGCTTCTACAGTCCACTCACAACAAACAGCGCTTTGATCAACCCTTAGAGGCC
TCTACCTGGCTGAAGAATTTCAAAACTACCAATGAGCGCTTCCTGAGTCAGATAAAAGTTCAAGAGAAGTATGTTTGGAA
TAAGAGAGAAAGCACTGAGAAAGGCAGTCCTCTGGGAGAAGTTGTTGAACAGGGCCTAACCCGAGTGAGGAATGCCACTG
ACGCTGTTGGGGTCGTGCTGAAGGAGCTGAAGGCTCAGAGCGCCCTAGGGCTCTTTCACCTCCTGGTGGCTGTGGATGGA
GTCAATGCCCTCTGGGGAAGGACCACACTGAAA
Sequence Type mRNA
Unitrap ID UNI2291

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88732149..88737524 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068921 (Dap3) NM_022994 death associated protein 3 Gene [Source:MGI (curated);Acc:Dap3-001]

 
Come back to gene ENSMUSG00000068921


For any suggestions or comments, please send an email to unitrap@crg.es