Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_487E12-3
Clone ID CMHD-GT_487E12-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_487E12-3
Sequence
TGACTCTAAACCGGAACACAGAAATCCTGGAGATTTTAGAGATACCCCAGCTTATGGACACGTGTGTCCGAAACAGCTAT
CATGAAGAGGCGCTGGAGCTTGCCGCCTATGTACGGCGACTGGAAAGGAAGTACTCCTCCATCCCCGTTATCCAGGGCAT
TGTGAATGAAGTGCGCCAGTCCATGCAGCTGATGCTAAGCCAGCTGATCCAACAACTGAGGACTAACATCCAGCTCCCAG
CCTGCCTCCGTGTCATAGGCTATCTTCGGCGCATGGATGTCTTCACTGAGGCTGAGTTGAGGGTGAAATTTCTTCAGGCT
CGGGATGCTTGGCTCCGCTCCATCCTGACTGCCATCCCTAATGATGATCCTTACTTCCACATCACAAAAACCATTGAGGC
TTGCCGGGTCCATCTCTTTGATATCATCACCCAGTACCGTGCTATTTTCTCAGATGAGGACCCCCTGCTGCCACCTGCCA
TGGGCGAGTACACTGTGAATGAGGGTGCCATCTTCCATGGATGGGTGCTGCAGAAAATCTCACAGTTCCTGCAGGTGCTA
GAGACTGACCTTTACCGGGGTATAGGAGGCCGCTTGGACTCTCTGCTTGGCCAGTGCATGTACTTTGGGCTGTCCTTTAG
CCGGGTGGGGGCTGATTTCCGCGGCCAGTTGGCTCCTGTTTTCCAGAGGGTGGCAATCAGCACTTTCCAGAAAGCAGTTG
A
Sequence Type mRNA
Unitrap ID UNI37167

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109576375..109578076 569
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031916 (Cog8) NM_139229 component of oligomeric golgi complex 8 Gene [Source:MGI (curated);Acc:Cog8-001]

 
Come back to gene ENSMUSG00000031916


For any suggestions or comments, please send an email to unitrap@crg.es