Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_486F4-3
Clone ID CMHD-GT_486F4-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_486F4-3
Sequence
GAAAGGAATGCTTAATGATAGGGTCATGGACTTGTCCTCCCACCACGACCATCCTGCCCCTGCTGTTTGGCTGCCTGGGG
ATTTTCAGCCTCTTCAAGCTGCTGCAGAGGATCCGCTCAAAGGCTTACCTGAGGAATGCTGTGGTGGTAGTCACGGGCGC
CACCTCAGGTCTCGGCAGAGAATGTGCCAAAGTCTTCCATGCTGCGGGGGCTAAACTGGTCCTCTGTGGACGAAATGTGA
AGGCCCTGGAGGAGCTCAGCCGGGAACTTGCTGGTTCTTCTCAGGGACAGACACACCAACCCTTCGTGGTGACCTTTGAC
CTCGCGGATCCTGGTACTATTGCTGCTGCAGCAGCTGAGATCCTCCAGTGCTTTGGCTATGTGGACGTTCTCATCAATAA
TGCTGGGATTAGCTACCGTGGTACCATTAGTGATACCATAGTGGACGTGGACCGGAAGGTGATGGAAATAAACTACTTTG
GCCCTGTTGCTCTAACAAAAGCGCTCCTACCCTCCATGGTGGAAAGGAAGCAAGGCCACATCGTCGCCATCAGCAGCATC
CAGGGCAAGATCAGCATTCCTTTCCGATCGGCATATTCAGCCTCCAAGCATGCAACCCAGGCATTCTTTGACTGTCTGCG
TGCAGAGATGGAAGAGGCTAACATCAAGGTGACTGTGATAAGCCCTGGCTACATCCATACCAACCTCTCTGTAAATGCTG
TCACTGCCGATGGCTCCAGATATGGAGCTCTAGACAAGAACACAGCCCAGGGCCGAAGCGCTGCAGAGGTGGCCCAGGAT
GTCTTTGATGCTGTGGGG
Sequence Type mRNA
Unitrap ID UNI6534

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60657667..60671290 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042569 (Dhrs7b) NM_145428 dehydrogenase/reductase (SDR family) member 7B Gene [Source:MGI (curated);Acc:Dhrs7b-001]

 
Come back to gene ENSMUSG00000042569


For any suggestions or comments, please send an email to unitrap@crg.es