Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_486F12-3
Clone ID CMHD-GT_486F12-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_486F12-3
Sequence
GTGGGGTCGTTCTCATGTGGATCATCTCGAAAAGGATCCAGCTTCCCTCCGAGAAGGCCATCTTCCTGTTTGTGGACAAG
ACAGTCCCACAGTCCAGCCTAACTATGGGACAGCTTTACGAGAAGGAAAAAGATGAAGATGGATTCTTGTATGTGGCCTA
CAGCGGAGAGAACACTTTTGGCTTCTGAGGCCCTTGCTGGGCTAGGTGCGCCCTTCCTGCTTGTGTCTCTTGTAAATAAC
TGGCTGTTCTCAGTTACTCTGCCAGAGCCTCCACACAGACCTACTAGTGCATTTGTAACTGGATTTATTTCTTAATATAT
TGGAAGGTTTTGTTTCCTTAGATTAGTAAATTATCATACAGAG
Sequence Type mRNA
Unitrap ID UNI19271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114466490..114476480 269
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031950 (Gabarapl2) NM_026693 gamma-aminobutyric acid (GABA-A) receptor-associated protein-like 2 Gene [Source:MGI (curated);Acc:Gabarapl2-001]

 
Come back to gene ENSMUSG00000031950


For any suggestions or comments, please send an email to unitrap@crg.es