Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_485B12-3
Clone ID CMHD-GT_485B12-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_485B12-3
Sequence
TATATCGGCGTGGTTAACCGAAGCCAGAAAGACATCGAGGGCAAAAAGGACATCCGGGCTGCTCTGGCAGCCGAGAGGAA
ATTCTTCCTCTCCCACCCAGCCTACCGGCACATGGCTGACCGCATGGGCACCCCACACTTGCAGAAAACCCTGAACCAGC
AACTGGACCAACCACATCCGAGAGTCACTGCCGACCCTTCGCAGCAAGCTGCAGAGCCAACTGCTGTCCCTGGAGAAGGA
AGTGGAAGAGTACAAGAATTTCCGGCCTGATGACCCCACGCGCAAGACCAAAGCCCTGCTGCAGATGGTTCAGCAGTTTG
GAGTGGACTTTGAGAAGCGAATTGAAGGCTCGGGAGATCAAGTAGACACACTAGAGTTGTCTGGTGGAGCCCGCATCAAT
CGTATCTTTCATGAGCGCTTTCCCTTTGAACTGGTAAAGATGGAGTTTGATGAGAAAGATCTACGAAGAGAGATCAGCTA
TGCTATTAAGAACATCCACGGAGTCAGGACGGGGCTCTTCACCCCCGACATGGCCTTTGAAGCCATCGTGAAAAAACAGC
TTGTAAAACTCAAAGAGCCGAGTTTGAAGTGTGTTGACCTGGTGGTGTCGGAGCTAGCCACGGTCATTAAAAAGTGTGCT
GAGAAGCTGAGTTCCTACCCCCGGCTGCGAGAGGAGACCGAGCGAATTGTCACCACCTACATCAGGGAGCGAG
Sequence Type mRNA
Unitrap ID UNI26333

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21277059..21285843 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033335 (Dnm2) NP_001034609 dynamin 2 Gene [Source:MGI Symbol;Acc:MGI:109547]

 
Come back to gene ENSMUSG00000033335


For any suggestions or comments, please send an email to unitrap@crg.es