Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_485G4-3
Clone ID CMHD-GT_485G4-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_485G4-3
Sequence
GAGAGATAATGGCTTTTTTTTTTGTGGAACACATCTTTTGTCAACCCCAACGCTGCCTACGACAAGTTCAAGGACAAGAG
AGTGGGAACAAAGGGGCTTGATTTCTCAGATCGCATTGGAAAGACCAAGAGGACAGGATATGAGTCTGGAGACTATGAAA
TGGTTTGTTGTGTGATGACCGTGGGGTGAGCCTAGAGCAGGCCTGCAGGGGAGTGAGCAGTGTTAATCTTTGGGGCTTTG
TTTCTTTATTTTAAATTTCTCTCTCTCTTATTTTTTTGTCTTTGTTTTTTGCCTTGGGGATTAGTATTATTTTGTTGTGT
TTTTGTTGCCTGTTTCAAGACAGGGTTGCCCTGTGTACCGCTGGATGTCCTGGAACTTGCGCTGTAAACCACCCTGGCCA
TACACACAGAGAATCATCTGCCTCTGCCTGCCGGTGCTGGGATTACAGTCATGTACCAACGCAAATCAAAGAAAAAAAGA
AAAAAACATGGGGCCCCCCCAGACAGCAGCCTGGTCACCTATG
Sequence Type mRNA
Unitrap ID UNI26827

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126711791..126713858 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025410 (Dctn2) NM_027151 dynactin 2 Gene [Source:MGI Symbol;Acc:MGI:107733]

 
Come back to gene ENSMUSG00000025410


For any suggestions or comments, please send an email to unitrap@crg.es