Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_486D7-3
Clone ID CMHD-GT_486D7-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_486D7-3
Sequence
CATTAAAACTTCCTTTTGGCAAAACAACAGTGATGCATTTGGTGGCCAGAGAGACCCTGCCAGAGCCCAACTCACAAGGT
CAGAGAAATCGGGAGAAAACTGGTGAGAGCAACTGCTGTGTGATCCTGTAGCGTCGCCAGCACAGATGTGGCAGTTTGTT
GGCACTGCGGGGACAGAGGAGACTCAGCAGCTTCCAACACCTGTAGGACAGTCGCCAGCACATCCGTGGGACTGAATCAC
TCATGAACTCTGTCATCTCCTCTCACAAAGTAAAAAGAACCAAGAAC
Sequence Type mRNA
Unitrap ID UNI1312

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 149317555..149318099 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001687 (Ubl3) NM_011908 ubiquitin-like 3 Gene [Source:MGI Symbol;Acc:MGI:1344373]

 
Come back to gene ENSMUSG00000001687


For any suggestions or comments, please send an email to unitrap@crg.es