Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_482H8-3
Clone ID CMHD-GT_482H8-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_482H8-3
Sequence
GTGTCGCTACCTGGCTGTTCAGCTGTCTCCTGCCATTCCTGTGTTTGCCGCTATGCTCTTTCTTTTCTCCATGGCCACGC
TGTTGAGGACAAGTTTCAGTGACCCTGGAGTGATTCCTCGAGCACTACCAGATGAAGCAGCTTTCC
Sequence Type mRNA
Unitrap ID UNI37180

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 45547753..45547897 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036985 (Zdhhc9) NM_172465 zinc finger, DHHC domain containing 9 Gene [Source:MGI (curated);Acc:Zdhhc9-002]

 
Come back to gene ENSMUSG00000036985


For any suggestions or comments, please send an email to unitrap@crg.es