Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_481A11-3
Clone ID CMHD-GT_481A11-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_481A11-3
Sequence
TGAAGCCAATAAGCAACATGTAAGATGTCAGAAATGCTTGGAATTTGGACATTGGACTTATGAATGCAAAGGGAAAAGAG
AGCACCTACACAGACCTTCGAGAACGGCAGAGCTGAAGAAAGCTTTAAAAGAAAAAGAAGATAGATTATTGCTGCAAAGC
ATAGGAGAGACCAACTT
Sequence Type mRNA
Unitrap ID UNI11583

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53140771..53140929 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018239 (Zcchc10) NM_026479 zinc finger, CCHC domain containing 10 Gene [Source:MGI (curated);Acc:Zcchc10-001]

 
Come back to gene ENSMUSG00000018239


For any suggestions or comments, please send an email to unitrap@crg.es