Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_506E11-3
Clone ID CMHD-GT_506E11-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_506E11-3
Sequence
AGAAATGCAGGCAGTAGTTCAGATGGAACCGAAGATTCCGATTTTTCTACAGATCTCGAGCATACAGACAGTTCAGAGAG
TGATGGCACCTCGCGCCGATCTGCCCGAGTCACCCGCTCCTCAGCCAGGCTAAGCCAGAGTTCCCAAGATTCCAGCCCTG
TTCGAAATTTGCCGTCTTTCGGCACTGAGGAGCCTGCCTATTCTACCAGAAGGGTGACCCGTAGTCAGCAGCAGCCCACG
CCAGTGACTCC
Sequence Type mRNA
Unitrap ID UNI17568

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95164521..95167510 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038909 (Myst2) NM_177619 MYST histone acetyltransferase 2 Gene [Source:MGI (curated);Acc:Myst2-002]

 
Come back to gene ENSMUSG00000038909


For any suggestions or comments, please send an email to unitrap@crg.es