Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_506F4-3
Clone ID CMHD-GT_506F4-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_506F4-3
Sequence
GGATGTGACGCTCCACATTCTTAGTGACACAAGAACTATTTACATAGCCAACAGGTTTCCTCAGAATGGCCTTTACACAC
CTCAGAAATTTATAGATAACCGGATCATTTCATCTAAGTATACTATATGGAATTTTGTTCCAAAAAATTTAATTGAACAG
TTCAGAAGAGTGGCAAACTTTTATTTTCTTATTATATTTTTGGTTCAGCTTATGATTGATACACCTACCAGTCCAATTAC
CAGTGGACTTCCATTATTCTTTGTGATAACAGTAACTGCCATAAAACAGGGTTATGAAGACTGGTTACGCCATAACTCAA
ATAATGAAGTAAACGGAGCTCCTGTCTATGTTGTCAGAAGTGGGGGGCTTGTAAAAACTCGATCCAAAAACATTCGGGTG
GGTGATATTGTTCGTATAGCCAAAGATGAAATTTTTCCTGCAGACTTGGTGCTTCTGTCCTCAGATCGACTTGATGGTTC
ATGTCATGTGACAACTGCTAGTTTGGATGGAGAGACAAACCTAAAGACACATGTGTCAGTTCCAGAAACAGCAGTATTAC
AAACAGTTGCCAACTTGGACAGTCTCATAACTGTAATAGAATGCCAACAGCCAGAAGCAGATTTATACAGATTTATGGGA
CGAATGATAATAACTCAACAAATGG
Sequence Type mRNA
Unitrap ID UNI37186

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35676947..35694715 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037400 (Atp11b) NM_029570 ATPase, class VI, type 11B Gene [Source:MGI (curated);Acc:Atp11b-001]

 
Come back to gene ENSMUSG00000037400


For any suggestions or comments, please send an email to unitrap@crg.es