Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_504B3-3
Clone ID CMHD-GT_504B3-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_504B3-3
Sequence
CATGCTTGCTCATAGTCTTCTTCTGGGACCAGTTCCCAAAGGTCTATGTGCCCACGGTGTTTGAAAACTATGTGGCGGAT
ATCGAGGTGGATGGGAAGCAGGTAGAGTTGGCTTTATGGGACACAGCTGGACAGGAAGATTATGACCGCCTGCGGCCTCT
CTCTTATCCAGACACCGATGTTATATTGATGTGTTTTTCCATTGACAGCCCTGATAGTTTAGAAAACATCCCAAAAAAAT
GGACTCCAAAAATCAAGCATTTCTGTCCAAATGTGCCCATCATCCTGGTTGGGAACAAGAAGGACCTTCGGAATGACGAG
CACACGAGACGGGAGTTGGCCAAAATGAAGCAGGAGCCGGTAAAACCTGAAAAAGGCAGAGATATGGCAAACAGGATTGG
CGCTTTTGGGTACATGGAGTGTTCAGCAAAGACCAAAAATGGAGTGAGAGAGGTTTTTGAGATGGCCTCGATAGCTGCTC
TGCAAGCTAGACGTGGGAAGAAAAAGTCTGGGTGCCTCATCTTGTGAAGCCTTGTGAACGCAGCCTCATGCGGTTAATTT
GAAGTGCTGTTTATTAATCTTAGTGTATGATTACTGGCCTTTTCATTTATCTATAAT
Sequence Type mRNA
Unitrap ID UNI16761

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108229972..108239242 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007815 (Rhoa) NM_016802 ras homolog gene family, member A Gene [Source:MGI Symbol;Acc:MGI:1096342]

 
Come back to gene ENSMUSG00000007815


For any suggestions or comments, please send an email to unitrap@crg.es