Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_512B3-3
Clone ID CMHD-GT_512B3-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_512B3-3
Sequence
AGAACGGAAGGCTCCCTTAATGGAACTTAAGACAGTCAAGGCAGTGCACGTCCCTGGGAGGTCGTCCATGTCCCGAGAAG
AGCAGCCGATTCCTGGATTGCGAGAGTCCTGTGCACGTATTTATGAACCTGTCCCCACCGAAAGCAGTAATCCTTCAGGC
CAAGCCATCCAATTTTAAACCCCGCTGCCTTGTTCATGTTGGGTATACAGAGACTCAGAGGCGCTAGTTAATGGCCAGCC
TGACCTGTCTTCCTTGTGTTTCGGGGGGTGAAAGGAGGTTCCAGGAGAATAATGCCCTGGAATATTCTGAGGCTGAAATG
TTGTGTCTCGGATAGACAGAGTACTTCTCCGTGGGTCCTCCTGCACAGAAGCCCCCTTCTGCTCTGTTGTCAATCACTGG
GTTAGTTTTTTGTTTTGTTTTGTTTCTGTTGTTCTCTTCTTTCTGGGTTGATCTTAATCTTTGGAAATACACAGTGCTGC
TCAGGTTTGCCTGGTTCCCCTGTGTGACCTTCCCCCCCACACACACACAAAGTCAACCAGCTGACTGGGAGCAATGCTCG
TGGAATGGCCAGTCACTTGAAGACAGACCTCAAGCCAGCAATGGCAACTGGAGCGAGCACTTAAAGCGCACCTTGATCTT
CCTTTCCGTTCCATGCCGAAGGCCCAAAGAAGAGAAATGGCTGGCTACAACAACTGTTATTATTTTTTTAATAGTAAAAG
GAAATATGTACTTTTCTCACTA
Sequence Type mRNA
Unitrap ID UNI16783

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106515735..106516476 740
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es