Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_512B2-3
Clone ID CMHD-GT_512B2-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_512B2-3
Sequence
GGCAGAGATGATCTCCATCTTGCGAAGTCCCTAAGCTCTTCACCTCACACTAACCCTGATCAAGCCTGATGCAGTTGCCC
ACCCACTGATCCTGGAGGCTGTTCATCAGCAGATTCTGAGCAACAAGTTCCTCATTGTACGAACCAGGGAACTGCAGTGG
AAGCTGGAGGACTGCCGGAGGTTTTACCGAGAGCATGAAGGGCGTTTTTTCTATCAGCGGCTGGTGGAGTTCATGACAAG
TGCGCCAATCCGAGCCTATATCCTTGCCCACAAACATGCCATCCAACTTTGGAGGACGCCGATGGGACCCACCATAGTAT
TTCGAGCACGCTATATAGCCCCAGATTCAATTCTTGGAAGTTTGGGCCTCACTGACACCCGAAATACTACCCATGGCTCA
TACTCCGTGGTTTCCGCCAACACAGACATTGCAACCTTCTTCCCTGACTTCAGGGAACAGCACTGGCATGAGGAGCAGGA
ACCCCAGCTGCGGCGTGGTCCTGTGCACTACAGTCCAGAGGAAGGCATCCACTGTGCAGCTGGAACAGGAGGCCACAAAC
AACCTAACAAAGC
Sequence Type mRNA
Unitrap ID UNI37187

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109737832..109745135 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032478 (Nme6) NM_018757 non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase) Gene [Source:MGI (curated);Acc:Nme6-001]

 
Come back to gene ENSMUSG00000032478


For any suggestions or comments, please send an email to unitrap@crg.es