Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_465D8-3
Clone ID CMHD-GT_465D8-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_465D8-3
Sequence
GTCGCTGTTTTTTTGTCCGATCTTGATTTTGGCACTCCTGGAAAGACTGACAGATAAACACTTGGCCAAGGCCATATACC
TGTTTCCGTCCCAGATGATCGAGCTGAACAACGAACCTGTCTCATCTGTGGGGACCGCGCTACCGGCTTGCACTATGGGA
TCATCTCCTGCGAGGGCTGCTAGGGGTTTTTCAAGAGGAGCATTTGCAACAAACGGGTGTATCGGTGCAGTCGTGACAAG
AACTGTGTCATGTCCCGGAAGCAGAGGAACAGATGTCAGTACTGCCGCCTGCTCAAGTGTCTCCAGATGGGCATGAACAG
GAAGGCTATCAGAGAAGATGGCATGCCTGGAGGCCGGAACAAGAGCATTGGACCAGTCCAGATACC
Sequence Type mRNA
Unitrap ID UNI13761

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38604356..38728158 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063972 (Nr6a1) NM_010264 nuclear receptor subfamily 6, group A, member 1 Gene [Source:MGI (curated);Acc:Nr6a1-001]

 
Come back to gene ENSMUSG00000063972


For any suggestions or comments, please send an email to unitrap@crg.es