Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_514E2-3
Clone ID CMHD-GT_514E2-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_514E2-3
Sequence
AAATCTGGTGCCAGAGTTTGGTTTGAACTAACTAATGAAGAAAGCATTCTCTACTGGTCCTCAGTCTCAAGAGTGGTGAA
CCCCTGCACCTAGCAGGCTCTCTGGG
Sequence Type mRNA
Unitrap ID UNI37196

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 104119483..104125538 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049929 (Lpar4) NM_175271 lysophosphatidic acid receptor 4 Gene [Source:MGI (curated);Acc:Lpar4-001]

 
Come back to gene ENSMUSG00000049929


For any suggestions or comments, please send an email to unitrap@crg.es