Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_500B10-3
Clone ID CMHD-GT_500B10-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_500B10-3
Sequence
GACCTTCTTTTGGAGACGTGCTAGAGAGTGAGAAGGCAAAAATGAGGGTAGCAGGAGCTGCAAAGTTGGTAGTGGCCGTG
GCAGTATTCTTACTGACCTTCTATGTTATTTCTCAAGTATTTGAAATTAAAATGGATGCAAGTTTAGGAAATCTATTTGC
TCGATCCGCGCTGGACTCAGCCATTCGTTCTACGAAACCTCCGAGGTACAAGTGTGGGATCTCAAAGGCGTGCCCAGAGA
AGCATTTTGCTTTTAAGATGGCTAGTGGAGCAGCCAATGTCGTGGGACCCAAGATCTGCCTGGAGGACAATGTTTTGATG
AGTGGTGTGAAGAATAATGTCGGAAGAGGAATCAATATTGCCTTGGTAAATGGGAAAACAGAGG
Sequence Type mRNA
Unitrap ID UNI13352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 22272286..22293319 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029672 (D6Wsu176e) NM_138587 Protein FAM3C Precursor [Source:UniProtKB/Swiss-Prot;Acc:Q91VU0]

 
Come back to gene ENSMUSG00000029672


For any suggestions or comments, please send an email to unitrap@crg.es