Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_491H6-3
Clone ID CMHD-GT_491H6-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_491H6-3
Sequence
CCGCCTGGACACAGACCTCCTCCTGGGTTCCTCCTGTATCCTGAAGACTATCCTGACCCTCACCGGAGTCTCCAGTCTTG
AGGATGTGAAGAGCAATCAGGAAAGTGACTGCATGTTCAAAAAAAAAATGGTCCCTGACTTCTATGTTGACAGCATTGCC
GACCTCTTGCCTGCCCTTCAAGGTTAAAGATCTAGTGTCTTTAATCTCTGGAAT
Sequence Type mRNA
Unitrap ID UNI8914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24608326..24608539 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043445 (Pgp) NM_025954 phosphoglycolate phosphatase Gene [Source:MGI Symbol;Acc:MGI:1914328]

 
Come back to gene ENSMUSG00000043445


For any suggestions or comments, please send an email to unitrap@crg.es