Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_495G7-3
Clone ID CMHD-GT_495G7-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_495G7-3
Sequence
TGGGCAGTCAAAGATCTATGCCTACATGAGTCCGAACAAGTGCTCTGCAATGCGCTCTCCACTTCAGGAAGAGAACTCGG
TTGCCCATCATGAGGTCAAATGCCCGGGGAAACCATTAGCTGGAATCTACAGGAAGCGAGAAGAGAAAAGGAACACCGGG
AACGTTATACGAAGCGCTGTGAAGTCAGATGAACAGAAGAGCAAAGACACCAGGAGAGGTCCCCTGGCGCCTTTTCCAAA
CC
Sequence Type mRNA
Unitrap ID UNI17985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124897237..124900768 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049327 (Setd8) NM_030241 SET domain containing (lysine methyltransferase) 8 Gene [Source:MGI (curated);Acc:Setd8-001]

 
Come back to gene ENSMUSG00000049327


For any suggestions or comments, please send an email to unitrap@crg.es