Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_499G7-3
Clone ID CMHD-GT_499G7-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_499G7-3
Sequence
GTCTGTACAGCCCTGTTTTTTACCCGAAGACATGTTTCTGGAGGGCTCAACAAAGCTGTGCAAAAATGTGAAGACGGCGG
TGGACTGTGGGGCCGTAAAGCACTGCCAGCAGATGGTCTGGAGCAAGCCCACAGCGAAATCCCTTCCTTGCGACATATGC
Sequence Type mRNA
Unitrap ID UNI37214

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 59754388..59755276 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004207 (Psap) NM_011179 prosaposin Gene [Source:MGI (curated);Acc:Psap-001]

 
Come back to gene ENSMUSG00000004207


For any suggestions or comments, please send an email to unitrap@crg.es