Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST418880
Clone ID OST418880
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST418880
Sequence
CTCTGATGGCTGGCGGGATGCANGNTATGACTATCTCTGCATAGATGACTGTTGGATGGCTCCCGAGAGGGATTCAAAGG
GCAGGCTTCAGGCAGATCCCCAACGCTTTCCTAGTGGGATCAAACACCTCGCAAATTACNGTCCACAGCAAAGGATTGAA
GCTAGGGATTTATGCAGATGTTGGGAATAAAACCTGTGCAGGTTTCCCCGGGAGTTTTGGATCCTATGACATTGATGCGC
AGACATTTGCTGACTGGGGCGTAGATCTGCTAAAATTTGATGGTTGTCACTGTGACAGTGTAGTATCCTTGGAGAATGGT
TATAAGTACATGGCCTTGGCCTTGAACAGGACAGGCCGAAGCATTGTATACTCCTGTGAGTGGCCACTTTATTTGAGACC
CTTTCATAAGCCCAATTATACAGATATCCAATATTACTGCAATCATTGGAGAAATTTTGATGATGTTTATGATTCCTGGG
AAAGCATAAA
Sequence Type mRNA
Unitrap ID UNI18639

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 131126686..131130952 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031266 (Gla) NM_013463 galactosidase, alpha Gene [Source:MGI (curated);Acc:Gla-001]

 
Come back to gene ENSMUSG00000031266


For any suggestions or comments, please send an email to unitrap@crg.es