Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_494B11-3
Clone ID CMHD-GT_494B11-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_494B11-3
Sequence
GACGTGTGAGGGGGAAACTCCCATTCACAAGGCGGCCCGCTCAGGGAGCCTCGAGTGCATCACTGCCCTGGTAGGGAGCG
GGGCTCACACCGACCTGAGAAATGCCAGTGGCCTGACAGCAGCAGACATTGCACAAACCCAGGGTTTCCAAGAGTGCACC
CAGTTTCTCTTGAGCCTCCAGAACCATCAAATGAGCCGTTTCTGTCATAATGGCACCTTGAGTGGAGGTCATGAGAGCAT
ACTGCCCACTCACGTTAGCCTGGGAACAAACCGAAAAAAAAAAAAAAAAAAAAAAAAAAACTTTGGGAGTGAATAAAGCT
AAAAAAAAAATTCCCAGCCTGGATCACGCCATGCCTCTAGCAAATGGAGAGGCTGAAGATGATGCCGACAGAATGCACGT
GGACAGAGAGTGTGCTGCTGTATCAGGTGGGACTGGACAGTTTCCTGTTAGCTGCAACAACACCCCAGTGGTGGAGGACA
CCAAGCAACAGGAGAGTAGTTCTGTTGGACCTAAAGAAATAGAGATATATACTGTTTCAGCAATGCAAACCCCTTGTCGT
TGCAAGAATCAGTATGCTTACTATTTCTGAGTTCTCAAACTTTGCACTTTCTTGTCCAGTGTCTTGAAC
Sequence Type mRNA
Unitrap ID UNI8219

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11615613..11628527 298
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031508 (Ankrd10) NM_133971 ankyrin repeat domain 10 Gene [Source:MGI Symbol;Acc:MGI:1921840]

 
Come back to gene ENSMUSG00000031508


For any suggestions or comments, please send an email to unitrap@crg.es