Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_493F8-3
Clone ID CMHD-GT_493F8-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_493F8-3
Sequence
CACCAGCAGAACCGAGACCGTGCGTGGTGGCAGGTCTTCCTCTTCCTTCAAACCTCGCCCTGAACAGACAAGAAAACAGG
GAAGGGGTGGGGCCCTGGTGAGGCTGGACCGCCCTGGCCGGATGGATCACCAGGAATGCAGTCTGGGAGGACAGATACTG
TCTTGTTAAGTTTTGTTATCCGTAACTTTCTATCCATGTGTACATATTACATGCCCCAGTGGGATCTTCTTTCCCCGTTC
AGAACCTCCACTGAGGATGGGGCCTTTGTCAAACACTGTTGAAGGAGAGGCAACTGTGTCTGCTGGTAGAGTTCCTAAGG
CTCTGAAGATGACCAGTTGGTGATGTTCTCCAGGAAGTGGACTGAGACTTGCTACCGGAGCTGGTTAAGTCAGGTTAGGC
TCCCAGTACCATCAAACATGTCAGCCTTCCTTCGTGCCTGATGGATCATGGCTTTAACCCACCAGGACCCTGTCTGGGAG
CCTCCTGGCTAAGATCAACTGTGCCTTGGCTAGCCCGATTCACGTCTGGGTTCCCACTTGGCACAGCCAGCGCCCACCGC
ATGGGCTCAGGGATTCTTACTCAGACGCTGTCAACTTCCGGAAGACCTCAGGGAGGGTCGGACTTCTCCAAGAACCCCTC
AAAGGTGCCACAAAATGAATCAAACTTGAGAGGCTTCAAGTCTGACTCGGTCCTACATGGAAGCCCCTTGATTGGTCCCC
AAGGGTGCAAACTACTGCCACCTTTGCTGGAGCCAAGTAGCCAGTCACCATGCCGTTGTACCCAGCGGCCTGTGCCTTTG
TCAGCTCTGTTTTCAGAAGACCCTGCCAATGACTGAACTGGATCTGTC
Sequence Type mRNA
Unitrap ID UNI16696

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 118357546..118358395 836
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040093 (Bmf) NM_138313 BCL2 modifying factor Gene [Source:MGI (curated);Acc:Bmf-001]

 
Come back to gene ENSMUSG00000040093


For any suggestions or comments, please send an email to unitrap@crg.es