Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_494H6-3
Clone ID CMHD-GT_494H6-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_494H6-3
Sequence
TTTGGGGGTGCCTCTCATGCAAAGGGAATTGTGCTGGAAAAAGTAGGGGTTGAGGCCAAACAGCCAAATTCTGCCATCAG
GAAGTGCGTCAGGGTGCAGCTCATTAAGAACGGGAAGAAGATCACAGCGTTCGTGCCCAATGATGGCTGCCTGAACTTCA
TTGAGGAAAATGATGAAGTTCTGGTTGCTGGATTTGGTCGAAAAGGTCATGCTGTAGGTGATATTCCTGGAGTCCGCTTT
AAGGTGGTTAAAGTAGCCAATGTTTCTCTGTTGGCTCTATACAAAGGCAGGAAAGAAAGGCCAAGATCATAAAATTTGAC
AATGGAAACACAGTAATAAATTTTCATATTCGG
Sequence Type mRNA
Unitrap ID UNI37215

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 91063308..91064327 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049517 (Rps23) NM_024175 ribosomal protein S23 Gene [Source:MGI Symbol;Acc:MGI:1913725]

 
Come back to gene ENSMUSG00000049517


For any suggestions or comments, please send an email to unitrap@crg.es