Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_453E4-3
Clone ID CMHD-GT_453E4-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_453E4-3
Sequence
AAGATATGTGGTGACATCCACGGGCAGTACTATGATTTGCTCCGTCTGTTTGAATACGGTGGCTTTCCTCCAGAGAGCAA
CTATTTGTTTCTCGGGGACTATGTGGACAGGGGCAAGCAGTCCCTGGAGACAATCTGCCTCTTGCTGGCCTACAAAATCA
AGTATCCGGAGAACTTCTTTCTTCTCAGAGGGAACCACGAGTGGCGCCAGCATCAATAGGATCTACGGATTTTATGATGA
GTGTAAAAGAAGATACAACATTAAGCTGTGGAAAACGTTCACAGACTGTTTTAACTGCTTGCCGATAGCAGCCATCGTGG
ACGAGAAGATATTCTGCTGTCATGGAGGTTTATCACCAGATCTTCAATCTATGGAGCAGATTCGGCGAATTATGAGACCA
ACTGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGTCTTAGGCTGGGGTGAAAA
TGACAGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGCAAAATTTCTCCATAAGCATGATTTGGATCTTATATGTA
GAGCCCATCAGGTGGTTGAAGATGGCTATGAGTTTTTTGCAAAGAGGCAGTTAGTCACTCTGTTTTCTGCACCCAACTAC
TGTGGCGAGTTTGACAATGCANGCGCCATGATGAGTGTGGATGAGACCCTCATGTGTTCCTT
Sequence Type mRNA
Unitrap ID UNI5260

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122618927..122623285 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004455 (Ppp1cc) NM_013636 protein phosphatase 1, catalytic subunit, gamma isoform Gene [Source:MGI (curated);Acc:Ppp1cc-001]

 
Come back to gene ENSMUSG00000004455


For any suggestions or comments, please send an email to unitrap@crg.es